Review



smartscribe reverse transcriptase kit  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    TaKaRa smartscribe reverse transcriptase kit
    Smartscribe Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase+kit/SMARTScribe+Reverse+Transcriptase/10__1021_slash_acsptsci__6c00117-175-37-41
    Average 96 stars, based on 1126 article reviews
    smartscribe reverse transcriptase kit - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Elucidating Regulatory Mechanisms of Genes Involved in Pathobiology of Sjögren’s Disease: Immunostimulation Using a Cell Culture Model
    Article Snippet: Samples were analyzed by using a Nanodrop lite plus spectrophotometer (ThermoScientific, Waltham, MA, USA) to ensure total RNA concentrations were above 150 ng for library prep and reverse transcription. .. For samples with no significant amount of DNA or protein contaminants, 500 ng RNA was reverse transcribed from each sample using the SmartScribe reverse transcriptase kit (Takara, Kusats, Shiga, Japan) following the manufacturer’s protocol. .. Random hexamers (IDT) and dNTP mix (NEB) were used. mRNA expression levels of ETS1, STAT1, and IL33 were determined relative to GAPDH, while miRNAs were determined relative to U6 small nuclear RNA 1 (U6) based on the ∆∆CT method using SYBR Green mix (Qiagen, Hilden, Germany). qRT-PCR primers are listed in .

    Article Title: Elucidating Regulatory Mechanisms of Genes Involved in Pathobiology of Sjögren’s Disease: Immunostimulation Using a Cell Culture Model
    Article Snippet: Samples were analyzed by using a Nanodrop lite plus spectrophotometer (ThermoScientific, Waltham, MA, USA) to ensure total RNA concentrations were above 150 ng for library prep and reverse transcription. .. For samples with no significant amount of DNA or protein contaminants, 500 ng RNA was reverse transcribed from each sample using the SmartScribe reverse transcriptase kit (Takara, Kusats, Shiga, Japan) following the manufacturer’s protocol. .. Random hexamers (IDT) and dNTP mix (NEB) were used. mRNA expression levels of ETS1, STAT1, and IL33 were determined relative to GAPDH, while miRNAs were determined relative to U6 small nuclear RNA 1 (U6) based on the ∆∆CT method using SYBR Green mix (Qiagen, Hilden, Germany). qRT-PCR primers are listed in Supplementary File S1.

    Article Title: Discovery, Structural Characterization, and Preclinical Evaluation of Monoclonal Antibodies against Xylazine Poisoning
    Article Snippet: Xylazine is a nonopioid sedative that has emerged as a major adulterant in the illicit drug supply, contributing to rising fatal overdoses across the United States.. Xylazine toxicity is not reversed by naloxone, and there are no current FDA-approved therapeutics to counteract its effects in humans.. To address this issue, we developed and characterized monoclonal antibodies (mAbs) capable of sequestering xylazine to prevent or treat acute toxicity.

    Article Title: Methods of sensitizing tumors to treatment with immune checkpoint inhibitors
    Article Snippet: For generation of personalized mRNA, total RNA was isolated from RNeasy kits (Qiagen), and cDNA libraries were generated by RT-PCR. .. Using a SMARTScribe Reverse Transcriptase kit (Takara), a reverse transcriptase reaction by PCR was performed on the total tumor RNA in order to generate cDNA libraries. .. The resulting cDNA was then amplified using Takara Advantage 2 Polymerase mix with T7/SMART and CDS III primers, with the total number of amplification cycles determined by gel electrophoresis.

    Article Title: Predicting dynamic expression patterns in budding yeast with a fungal DNA language model
    Article Snippet: .. After addition of oligo-dT primer (sequence: AAGCAGTGGTATCAACGCAGAG-TACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN), samples were lysed by three freeze-thaw cycles and incubated at 42°C for 3 minutes. cDNA synthesis was performed using the SMARTScribe Reverse Transcriptase kit (Takara), with 2.4 μM LNA template switch oligo (sequence: AAGCAGTGGTATCAAC-GCAGAGTACrGrG+G) and RNase inhibitor. .. For cDNA amplification, SeqAmp DNA polymerase (Takara) and ISO PCR primer (sequence: AAGCAGTGGTATCAACGCAGAGT) were added.

    Article Title: MSRB3 antioxidant activity is necessary for inner ear cuticular plate structure and hair bundle integrity.
    Article Snippet: RNAs from inner ear were extracted at P0 from Msrb3 wild-type, heterozygous and homozygous mice using a Ribopure kit (Ambion). .. A SMARTScribe Reverse Transcriptase kit (Clontech) was used to generate cDNAs, and SYBRgreen technology (Qiagen) was used to perform quantitative PCR using gene-specific primers. ..

    Article Title: A Subset of Transposable Elements as Mechano-Response Enhancer Elements in Controlling Human Embryonic Stem Cell Fate
    Article Snippet: After the final wash, cells were mounted in the Fluoroshield with DAPI (Abcam). .. Total RNA was extracted using the Direct-zol RNA MiniPrep Kit (Zymo Research, 11–331) according to manufacturer's instructions, treated with DNase to remove genomic DNA, and reverse transcribed using SMARTScribe Reverse Transcriptase kit (TaKaRa, 639538). .. Real-time Quantitative Analysis (RT-qPCR) was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, 1725122).

    Article Title: MSRB3 antioxidant activity is necessary for inner ear cuticular plate structure and hair bundle integrity
    Article Snippet: RNAs from inner ear were extracted at P0 from Msrb3 wild-type, heterozygous and homozygous mice using a Ribopure kit (Ambion). .. A SMARTScribe Reverse Transcriptase kit (Clontech) was used to generate cDNAs, and SYBRgreen technology (Qiagen) was used to perform quantitative PCR using gene-specific primers. ..

    Synthesized:

    Article Title: Discovery, Structural Characterization, and Preclinical Evaluation of Monoclonal Antibodies against Xylazine Poisoning
    Article Snippet: Xylazine is a nonopioid sedative that has emerged as a major adulterant in the illicit drug supply, contributing to rising fatal overdoses across the United States.. Xylazine toxicity is not reversed by naloxone, and there are no current FDA-approved therapeutics to counteract its effects in humans.. To address this issue, we developed and characterized monoclonal antibodies (mAbs) capable of sequestering xylazine to prevent or treat acute toxicity.

    Polymerase Chain Reaction:

    Article Title: Methods of sensitizing tumors to treatment with immune checkpoint inhibitors
    Article Snippet: For generation of personalized mRNA, total RNA was isolated from RNeasy kits (Qiagen), and cDNA libraries were generated by RT-PCR. .. Using a SMARTScribe Reverse Transcriptase kit (Takara), a reverse transcriptase reaction by PCR was performed on the total tumor RNA in order to generate cDNA libraries. .. The resulting cDNA was then amplified using Takara Advantage 2 Polymerase mix with T7/SMART and CDS III primers, with the total number of amplification cycles determined by gel electrophoresis.

    Sequencing:

    Article Title: Predicting dynamic expression patterns in budding yeast with a fungal DNA language model
    Article Snippet: .. After addition of oligo-dT primer (sequence: AAGCAGTGGTATCAACGCAGAG-TACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN), samples were lysed by three freeze-thaw cycles and incubated at 42°C for 3 minutes. cDNA synthesis was performed using the SMARTScribe Reverse Transcriptase kit (Takara), with 2.4 μM LNA template switch oligo (sequence: AAGCAGTGGTATCAAC-GCAGAGTACrGrG+G) and RNase inhibitor. .. For cDNA amplification, SeqAmp DNA polymerase (Takara) and ISO PCR primer (sequence: AAGCAGTGGTATCAACGCAGAGT) were added.

    Incubation:

    Article Title: Predicting dynamic expression patterns in budding yeast with a fungal DNA language model
    Article Snippet: .. After addition of oligo-dT primer (sequence: AAGCAGTGGTATCAACGCAGAG-TACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN), samples were lysed by three freeze-thaw cycles and incubated at 42°C for 3 minutes. cDNA synthesis was performed using the SMARTScribe Reverse Transcriptase kit (Takara), with 2.4 μM LNA template switch oligo (sequence: AAGCAGTGGTATCAAC-GCAGAGTACrGrG+G) and RNase inhibitor. .. For cDNA amplification, SeqAmp DNA polymerase (Takara) and ISO PCR primer (sequence: AAGCAGTGGTATCAACGCAGAGT) were added.

    cDNA Synthesis:

    Article Title: Predicting dynamic expression patterns in budding yeast with a fungal DNA language model
    Article Snippet: .. After addition of oligo-dT primer (sequence: AAGCAGTGGTATCAACGCAGAG-TACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN), samples were lysed by three freeze-thaw cycles and incubated at 42°C for 3 minutes. cDNA synthesis was performed using the SMARTScribe Reverse Transcriptase kit (Takara), with 2.4 μM LNA template switch oligo (sequence: AAGCAGTGGTATCAAC-GCAGAGTACrGrG+G) and RNase inhibitor. .. For cDNA amplification, SeqAmp DNA polymerase (Takara) and ISO PCR primer (sequence: AAGCAGTGGTATCAACGCAGAGT) were added.

    Real-time Polymerase Chain Reaction:

    Article Title: MSRB3 antioxidant activity is necessary for inner ear cuticular plate structure and hair bundle integrity.
    Article Snippet: RNAs from inner ear were extracted at P0 from Msrb3 wild-type, heterozygous and homozygous mice using a Ribopure kit (Ambion). .. A SMARTScribe Reverse Transcriptase kit (Clontech) was used to generate cDNAs, and SYBRgreen technology (Qiagen) was used to perform quantitative PCR using gene-specific primers. ..

    Article Title: MSRB3 antioxidant activity is necessary for inner ear cuticular plate structure and hair bundle integrity
    Article Snippet: RNAs from inner ear were extracted at P0 from Msrb3 wild-type, heterozygous and homozygous mice using a Ribopure kit (Ambion). .. A SMARTScribe Reverse Transcriptase kit (Clontech) was used to generate cDNAs, and SYBRgreen technology (Qiagen) was used to perform quantitative PCR using gene-specific primers. ..



    Similar Products

    96
    TaKaRa smartscribe reverse transcriptase kit
    Smartscribe Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase+kit/SMARTScribe+Reverse+Transcriptase/10__1021_slash_acsptsci__6c00117-175-37-41
    Average 96 stars, based on 1 article reviews
    smartscribe reverse transcriptase kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    TaKaRa smartscribe reverse transcriptase
    Smartscribe Reverse Transcriptase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase+kit/SMARTer+RACE+5%E2%80%99%2F3%E2%80%99+Kit/pm41427824-91-45-48
    Average 99 stars, based on 1 article reviews
    smartscribe reverse transcriptase - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    TaKaRa 5 race with smartscribe tm reverse transcriptase kit
    5 Race With Smartscribe Tm Reverse Transcriptase Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase+kit/SMARTScribe+Reverse+Transcriptase/pmc12698447-133-12-18
    Average 96 stars, based on 1 article reviews
    5 race with smartscribe tm reverse transcriptase kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa smartscribe rt kit
    Smartscribe Rt Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/smartscribe+reverse+transcriptase+kit/SMARTScribe+Reverse+Transcriptase/pmc12332422-61-18-21
    Average 96 stars, based on 1 article reviews
    smartscribe rt kit - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results